View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15998_low_7 (Length: 236)
Name: NF15998_low_7
Description: NF15998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15998_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 7432466 - 7432228
Alignment:
| Q |
1 |
tgaagaccaagacatggacccaatggtatagcttctctttcttcactgcaatggttattttatttcagctataggctgttcactgtactgtttttgttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7432466 |
tgaagaccaagacatggacccaatggtatagcttctctttcttcactgcaatggttattttatttcagctataggctgttcactgtactgtttttgttct |
7432367 |
T |
 |
| Q |
101 |
tccactacagcaatacttggagaataggctaaagcatcttgctcttgaaaaagcaaaagggaagta------------------ccatgtcactatgtct |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7432366 |
tccactacagcaatacttggagaataggctaaagcatcttgctcttgaaaaagcaaaagggaagtacctataccctcacaagttccatgtcactatgtct |
7432267 |
T |
 |
| Q |
183 |
actgacaatacattaaggaatatgaaggtttaaacaatg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7432266 |
actgacaatacattaaggaatatgaaggtttaaacaatg |
7432228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University