View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15998_low_8 (Length: 208)
Name: NF15998_low_8
Description: NF15998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15998_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 4 - 192
Target Start/End: Complemental strand, 42225388 - 42225200
Alignment:
| Q |
4 |
gttccttatacagttatacttggtctctctggcttcaaataattattggctcggtccctgaggctgatagtgtagttgtgttgaaactacctagtgtggc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42225388 |
gttccttatacagttatacttggtctctatggcttcaaataattattggctcggtccctgaggctgatagtgtagttgtgttgaaactacctagtgtggc |
42225289 |
T |
 |
| Q |
104 |
ttttacaaaaataatggccaacttgataccaaacaagcccttagtgaatgatatttgtgaagatgtttgagaaaatgacattagagtgt |
192 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42225288 |
ttttacaaaaataatggccaacttgaaaccaaacaagcccttagtgaatgatatttgtgaagatgtttgagaaaatgacattagagtgt |
42225200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University