View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15999_high_24 (Length: 326)
Name: NF15999_high_24
Description: NF15999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15999_high_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 56 - 304
Target Start/End: Complemental strand, 15382437 - 15382189
Alignment:
| Q |
56 |
gtatccgtgcttcatagacagtgacatagttagatcatgaacatgggtttttagacagaattgtatggatgagatagagagaattggaggtttatatatc |
155 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15382437 |
gtatccgtgcttcataggcggtgacatagttagatcatgaacatgggtttttagacagaattgtatggatgagatagagagaattggaggtttatatatc |
15382338 |
T |
|
| Q |
156 |
caatcagtgtccatatgggtgtcatgcaaaggaagtgatgatgataagatttcaagacaaatgcctaacatgcatagatggtcacnnnnnnngcgaagac |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15382337 |
caatcagtgtccatatgggtgtcatgcaaaggaagtgatgatgataagatttcaagacaaatgcctaacatgcatagatggtcactttttttgcgaagac |
15382238 |
T |
|
| Q |
256 |
atgggaataaagccatggtgctgtgactgtgtaactttgcaagtgttgt |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15382237 |
atgggaataaagccatggtgctgtgactgtgtaactttgcaagtgttgt |
15382189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University