View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15999_high_31 (Length: 255)
Name: NF15999_high_31
Description: NF15999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15999_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 21 - 243
Target Start/End: Original strand, 38216353 - 38216574
Alignment:
| Q |
21 |
aactgatgtatatcgtgtggacatttcattcaccaacatcaatactacagttacatttgcattatcatgacccacgaccacgattgatgcatacataatt |
120 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38216353 |
aactgatgtgtatcgtgtggacatttcattcaccaacatcaatactacagttacatttgcattatcatgacccacgaccacgattgatgcatacataatt |
38216452 |
T |
 |
| Q |
121 |
tccatgccatatatgggggaatcacaaagctagctctaaccaaatatgatacatgattgtatgtcattaagtaggatgcttcacatctttaaaat-aaaa |
219 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38216453 |
tccatgccatatat--gggaaccacaaagctagttctaaccaaatatgatacatgattgtatgtcattaagtaggatgcttcacatctttaaaataaaaa |
38216550 |
T |
 |
| Q |
220 |
agtcactcatggacgcctatgctt |
243 |
Q |
| |
|
| ||||||||||| |||||||||| |
|
|
| T |
38216551 |
aatcactcatggatgcctatgctt |
38216574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University