View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15999_high_36 (Length: 245)
Name: NF15999_high_36
Description: NF15999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15999_high_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 14 - 184
Target Start/End: Complemental strand, 46036262 - 46036092
Alignment:
| Q |
14 |
cataggacaaagcagtcgcaacaagaacattggatggatgaatatttgaattttcatttatgcctaaaaatactcactgataagagcctatttggtttaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46036262 |
cataggacaaagcagtcgcaacaagaacattggatggatgaatatttgaattttcatttatgcctaaaaatactcattgataagagcctatttggtttaa |
46036163 |
T |
 |
| Q |
114 |
tttatgatagggatttttcttttcttccagaattccagcataaaattgttgtctcaattgtattatgtatt |
184 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46036162 |
tttatgatagggatttttcttttctttcagaattccagcataaaattgttgtctcaattgtattatgtatt |
46036092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 176 - 226
Target Start/End: Complemental strand, 46035118 - 46035068
Alignment:
| Q |
176 |
ttatgtatttgtagctagctagccaatgccagaattggtggtgtacatatt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46035118 |
ttatgtatttgtagctagctagccaatgccagaattggtgttgtacatatt |
46035068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University