View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15999_high_41 (Length: 208)
Name: NF15999_high_41
Description: NF15999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15999_high_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 13 - 189
Target Start/End: Original strand, 3640914 - 3641090
Alignment:
| Q |
13 |
agatgaaccttactagtaattagtaactgattatactaatcttactataatgtaatatctctgttacattgtatgaagtctgaacttactcctctctccc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3640914 |
agatgaaccttactagtaattagtaactgattatactaatcttactataatgtaatatctctgttacattgtatgaagtctgaacttactcctctctccc |
3641013 |
T |
 |
| Q |
113 |
ttttcaannnnnnnncttcatgttgtgcagcatggaggtggacgggcgttcaaaactcttcaatggttagttcggag |
189 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3641014 |
ttttcaattttttttcttcatgttgtgcagcatggaggtggacgggcgttcaaaactcttcaatggttagttcggag |
3641090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 15 - 78
Target Start/End: Original strand, 3639782 - 3639850
Alignment:
| Q |
15 |
atgaaccttactagtaattagtaactgattatacta-----atcttactataatgtaatatctctgtta |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3639782 |
atgaaccttactagtaattagtaactgattatactaatcttatcttactataatgtaatatctctgtta |
3639850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University