View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15999_low_16 (Length: 390)
Name: NF15999_low_16
Description: NF15999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15999_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 3e-73; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 204 - 372
Target Start/End: Complemental strand, 39583427 - 39583259
Alignment:
| Q |
204 |
atgaacttctgaagtctcaatataagcatttctgatctctagtttttctttccctttcaaaatattggttttcacagcatttaccataaatgcttatatg |
303 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39583427 |
atgaacttctgaagtctcagtataagcatttctgatctctagtttttctttccctttcaaaatattggttttcgcagcatttaccataaatgcttatatg |
39583328 |
T |
 |
| Q |
304 |
gcaagtgttgacctgagnnnnnnntggtgtgacattctcatctcttgtgccagccagcaatgataacat |
372 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39583327 |
gcaagtgttgacctgagaaaaaaatggtgtgacattctcatctcttgtgccagccagcaatgataacat |
39583259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 11 - 136
Target Start/End: Complemental strand, 39583620 - 39583495
Alignment:
| Q |
11 |
cacagacacagatagtgatacggatactgatagtgataccgaaactgaaagtacttgaaggacaaaccaagttcctgatcaatagaaaaggaaacaactg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39583620 |
cacagacacagatagtgatacggatactgatagtgataccgaaactgaaagtacttgaaggacaaaccaagttcctgatcaatagaaaaggaaacaactg |
39583521 |
T |
 |
| Q |
111 |
cggcgtgttttacttcttttctgcta |
136 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
39583520 |
cggcgtgttttacttcttttctgcta |
39583495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 21 - 111
Target Start/End: Original strand, 39616604 - 39616697
Alignment:
| Q |
21 |
gatagtgatacggatactgatagtgataccgaaactgaaagtacttgaaggacaaaccaagttcc---tgatcaatagaaaaggaaacaactgc |
111 |
Q |
| |
|
||||||||||| |||||||||| |||||| ||||||||||||||| |||||||||| ||||||| ||||||||||||||||||||| |||| |
|
|
| T |
39616604 |
gatagtgatacagatactgatattgatacggaaactgaaagtactggaaggacaaatgaagttcctgatgatcaatagaaaaggaaacagctgc |
39616697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 15 - 111
Target Start/End: Original strand, 39627326 - 39627425
Alignment:
| Q |
15 |
gacacagatagtgatacggatactgatagtgataccgaaactgaaagtacttgaaggacaaaccaagttcctgat---caatagaaaaggaaacaactgc |
111 |
Q |
| |
|
||||| |||| |||||| |||||||||| ||||| ||||| ||||||||| |||||||||| ||||||| |||| ||||||||||||||||| |||| |
|
|
| T |
39627326 |
gacactgataatgatacagatactgatatcgatacagaaacggaaagtactggaaggacaaatcaagttcttgatgatcaatagaaaaggaaacagctgc |
39627425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University