View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15999_low_18 (Length: 377)
Name: NF15999_low_18
Description: NF15999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15999_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 16 - 359
Target Start/End: Complemental strand, 33102292 - 33101959
Alignment:
| Q |
16 |
atgaatgatgattctgtaaggacagacataataacggcgctgccaatttgcgaatatgaaggaaaaccatttgttagccagtttggcagcacactcattt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33102292 |
atgaatgatgattctgtaaggacagacataa---cggcgctgccaatttgcgaatatgaaggaaaaccatttgttagccagtttggcagcacactcattt |
33102196 |
T |
 |
| Q |
116 |
caagaagtcaactccactactacaacttatctgttctcattcaataatttctctatatttttgtaagtttgtaaggtgctctatattctttttgaagcaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
33102195 |
caagaagtcaactccactactacaacttatctgttctcattcaataatttctctatatttttttaag--------gtgctctatattctttttgaagcaa |
33102104 |
T |
 |
| Q |
216 |
caatttctcttattatatgattgatattataattaaaggaccgttgatttaagcaaatgaatttataaat-aatatttatttttgtaggagatattttta |
314 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33102103 |
caatttatcttattatatgattgatattataattaaaggaccgttgatttaagcaaatgaatttataaataaatatttatttttgtaggagatattttta |
33102004 |
T |
 |
| Q |
315 |
gtaaaatatgatcatggttcataatgggtgcaactgccattatgt |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33102003 |
gtaaaatatgatcatggttcataatgggtgcaactgccattatgt |
33101959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University