View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15999_low_26 (Length: 326)

Name: NF15999_low_26
Description: NF15999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15999_low_26
NF15999_low_26
[»] chr5 (1 HSPs)
chr5 (56-304)||(15382189-15382437)


Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 56 - 304
Target Start/End: Complemental strand, 15382437 - 15382189
Alignment:
56 gtatccgtgcttcatagacagtgacatagttagatcatgaacatgggtttttagacagaattgtatggatgagatagagagaattggaggtttatatatc 155  Q
    ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15382437 gtatccgtgcttcataggcggtgacatagttagatcatgaacatgggtttttagacagaattgtatggatgagatagagagaattggaggtttatatatc 15382338  T
156 caatcagtgtccatatgggtgtcatgcaaaggaagtgatgatgataagatttcaagacaaatgcctaacatgcatagatggtcacnnnnnnngcgaagac 255  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||    
15382337 caatcagtgtccatatgggtgtcatgcaaaggaagtgatgatgataagatttcaagacaaatgcctaacatgcatagatggtcactttttttgcgaagac 15382238  T
256 atgggaataaagccatggtgctgtgactgtgtaactttgcaagtgttgt 304  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
15382237 atgggaataaagccatggtgctgtgactgtgtaactttgcaagtgttgt 15382189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University