View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15999_low_37 (Length: 248)
Name: NF15999_low_37
Description: NF15999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15999_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 118 - 224
Target Start/End: Complemental strand, 38215999 - 38215893
Alignment:
| Q |
118 |
gaggttccattatcttaacagattggagagcagaacttggcatttgggttaaaatttgatgctaaaggagttatagattgttttgagaaagaattggaga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38215999 |
gaggttccattatcttaacagattggagagcagaacttggcatttgggttaaaatttgatgctaaaggagttatagattgttttgagaaagaattggaga |
38215900 |
T |
 |
| Q |
218 |
ctcttcc |
224 |
Q |
| |
|
||||||| |
|
|
| T |
38215899 |
ctcttcc |
38215893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University