View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15999_low_38 (Length: 247)
Name: NF15999_low_38
Description: NF15999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15999_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 26031716 - 26031603
Alignment:
| Q |
1 |
taattcattttatcttagttaattaaattattaaaatcaaaacagctcatataagtgaagtctaatccaagcaccttcacgttgcattgttttccaccca |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26031716 |
taattcattttatcttcgttaattaaattattaaaatcaaaacagctcatataagtgaagtctaatccaagcaccttcacgttgcattgttttccaccca |
26031617 |
T |
 |
| Q |
101 |
cccacctatctgtc |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
26031616 |
cccacctatctgtc |
26031603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 138 - 229
Target Start/End: Complemental strand, 26031585 - 26031494
Alignment:
| Q |
138 |
gtcattaccattacacaaaatttaatcacataatccaaattaaccttcactaatcaatttctatcataatatcttgtttagcaagaaagaca |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26031585 |
gtcattaccattacacaaaatttaatcacataatccaaattaaccttcactaatcaatttctatcataatatcttgtttagcaagaaagaca |
26031494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University