View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15999_low_44 (Length: 216)
Name: NF15999_low_44
Description: NF15999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15999_low_44 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 108 - 198
Target Start/End: Complemental strand, 29649834 - 29649744
Alignment:
| Q |
108 |
gttaatcattgtattaaagagcctttagtttgtttgttttatgatcactacaatccaaagaaaacataacatggacccccttagtcactag |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29649834 |
gttaatcattgtattaaagagcctttagtttgtttgttttatgatcactacaatccaaagaaaacataacatggacccccttagtcactag |
29649744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 12 - 61
Target Start/End: Complemental strand, 29649930 - 29649881
Alignment:
| Q |
12 |
tcatcataaaaaagaatcacatgcaattactttcttcattggtgagtaac |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29649930 |
tcatcataaaaaagaatcacatgcaattactttcttcattggtgagtaac |
29649881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University