View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16000_high_11 (Length: 294)
Name: NF16000_high_11
Description: NF16000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16000_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 4 - 274
Target Start/End: Original strand, 13974870 - 13975140
Alignment:
| Q |
4 |
ggattgtcttgaggaaacttaacaacattagtagcaacagtaacactctttccaagattcttatttgtaagataaggttcatcagattcccaaattcttc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13974870 |
ggattgtcttgaggaaacttaacaacattagtagcaacagtaacactctttccaagattcttatttgtaagataaggttcatcagattcccaaattcttc |
13974969 |
T |
 |
| Q |
104 |
caagtgtatcatttgctgatgtaattagaggtcctccattgttcaacctaaaaacaggctggaaagcataggctgttaatccgttaaccggggcgactgg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13974970 |
caagtgtatcatttgctgatgtaattagaggtcctccattgttcaacctaaaaacaggctggaaagcataggctgttaatccgttaaccggggcgactgg |
13975069 |
T |
 |
| Q |
204 |
gaaaagtcccgagccggtgtcaacgattaggctatctggcgccgtaacaacctcgattgcattgataaacg |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13975070 |
gaaaagtcccgagccggtgtcaacgattaggctatctggcgccgtaacaacctcgattgcattgataaacg |
13975140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University