View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16000_high_9 (Length: 305)
Name: NF16000_high_9
Description: NF16000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16000_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 15 - 288
Target Start/End: Original strand, 26670187 - 26670460
Alignment:
| Q |
15 |
tctgaagaagtttaagaatggtgaggttagagttcttgtgactaacgaattatcagcaagaggtttggatgtggcagaatgtgatcttgtggtaaacctg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26670187 |
tctgaagaagtttaagaatggtgaggttagagttcttgtgactaacgaattatcagcaagaggtttggatgtggcagaatgtgatcttgtggtaaacctg |
26670286 |
T |
 |
| Q |
115 |
gacttaccgacagattcaattcactatgcacaccgagctggtcgaactggtcggcttggtaggaatggtactgtgctgaccatatgtgaagagtcagagg |
214 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26670287 |
gacttaccgacagattctattcactatgcacaccgagctggtcgaactggtcggcttggtaggaatggtactgtgctgaccatatgtgaagagtcagagg |
26670386 |
T |
 |
| Q |
215 |
tttttgttgtgagaaaattgaagaagcaacttgaaataccgattgcttgctgtaatttcgttgagggaaagctt |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26670387 |
tttttgttgtgagaaaattgaagaagcaacttgaaataccgattgcttgctgtaatttcgttgagggaaagctt |
26670460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University