View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16001_high_3 (Length: 245)
Name: NF16001_high_3
Description: NF16001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16001_high_3 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 17 - 245
Target Start/End: Original strand, 6734467 - 6734695
Alignment:
| Q |
17 |
ctattaccgcttcgccaagtgcgataacacctgcagccactgccaccaccactacaacaccggtttctggtggagatatcaatccagaccctttagtctc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6734467 |
ctattaccgcttcgccaagtgcgataacacctgcagccactgccaccaccactaccacaccggtttctggtggagatatcaatccagaccctttagtctc |
6734566 |
T |
 |
| Q |
117 |
agaaaatgaagcaccagttgtggacatccctccagttgtgagtcctaccacagatgaaacaccagaagaacttccacaaccagaagctgaagtgccactt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6734567 |
agaaaatgaagcaccagttgtggacatccctccagttgtgagtcctaccacagatgaaacaccagaagaacttccacaaccagaagctgaagtgccactt |
6734666 |
T |
 |
| Q |
217 |
ccaccgccagaaactgaggtgccactccc |
245 |
Q |
| |
|
|||||||||||| ||||||| |||||||| |
|
|
| T |
6734667 |
ccaccgccagaagctgaggtaccactccc |
6734695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University