View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16002_high_9 (Length: 215)
Name: NF16002_high_9
Description: NF16002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16002_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 20 - 199
Target Start/End: Original strand, 31696012 - 31696191
Alignment:
| Q |
20 |
ggaatcaagcaagagtttgggattggatggttgatgttgcaccttgaagaccatgttcccggatgcattggtgaactctagggtgccacgtggaatttgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
31696012 |
ggaatcaagcaagagtttgggattgggtggttgatgttgcaccttgaagaccatgttcccggatgcattggtgaactctagggtgccacgtggaactcgg |
31696111 |
T |
 |
| Q |
120 |
gcgtcttctttggaacagaagagatcgattgggatgtgttcatcttctgtgcctgtatattcccaatcttctgaagtttc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31696112 |
gcgtcttctttggaacagaagagatcgattgggatgtgttcatcttctgtgcctgtatattcccaatcttctgaagtttc |
31696191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 36 - 188
Target Start/End: Original strand, 31689861 - 31690013
Alignment:
| Q |
36 |
ttgggattggatggttgatgttgcaccttgaagaccatgttcccggatgcattggtgaactctagggtgccacgtggaatttgggcgtcttctttggaac |
135 |
Q |
| |
|
||||||| || ||||||| | |||||||||||||| |||||||| ||||||| || ||| ||||| |||||||||||| | ||||| || |||||||| |
|
|
| T |
31689861 |
ttgggatcgggtggttgacggtgcaccttgaagactatgttccccgatgcatctgtaaacgctaggatgccacgtggaactccggcgtgttttttggaac |
31689960 |
T |
 |
| Q |
136 |
agaagagatcgattgggatgtgttcatcttctgtgcctgtatattcccaatct |
188 |
Q |
| |
|
||| ||||||||||||||||||| |||||| |||||||| || ||| ||||| |
|
|
| T |
31689961 |
cgaaaagatcgattgggatgtgttgatcttcggtgcctgtgtactccaaatct |
31690013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University