View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16002_low_17 (Length: 201)
Name: NF16002_low_17
Description: NF16002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16002_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 20 - 186
Target Start/End: Complemental strand, 45739847 - 45739681
Alignment:
| Q |
20 |
ataagcgtggttacattgttcagcgaccgtagattcataaccgtattccatacctgtgtatgaaagttgctttgtaagtctcttgcattgatcaaaagtt |
119 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45739847 |
ataagcgtggttacattgttcagcggccgtagattcataaccgtattccatacctgtgtatgaaagttgctttataagtctcttgcattgatcaaaagtt |
45739748 |
T |
 |
| Q |
120 |
tcttggattgatcggatcataacttctgatgacacaaaatctatcgtttgttacgacccgacctttg |
186 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45739747 |
tcttggattgatcggatcataacttctgacgacacaaaatctatcgttggttacgacccgacctttg |
45739681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University