View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16003_high_53 (Length: 247)
Name: NF16003_high_53
Description: NF16003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16003_high_53 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 233
Target Start/End: Complemental strand, 32950558 - 32950344
Alignment:
| Q |
18 |
atccatgtggtttatgttttggccctttttagtcttttatttaaatattgatttaactgctctctgattataccacacaaaaggtaaacagaattcaccc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32950558 |
atccatgtggtttatgttttggccctttatagtcttttatttaaatattgatttaactgctctctgattataccacacaaaaggtaaacagaattcaccc |
32950459 |
T |
|
| Q |
118 |
caaaaagaatataaagaatatggttttcatttgtacacattattggagaagctgtttttcagtgggaacaatttggcatgttgcatatcatataaagaat |
217 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32950458 |
caaaaagaatataaa-aatatggttttcatttgtacacattattggagaagctgtttttcagtgggaacaatttggcatgttgcatatcatataaagagt |
32950360 |
T |
|
| Q |
218 |
ttcattgttttgaatt |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
32950359 |
ttcattgttttgaatt |
32950344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University