View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16003_high_57 (Length: 237)
Name: NF16003_high_57
Description: NF16003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16003_high_57 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 55173885 - 55174108
Alignment:
| Q |
1 |
tataagaaacttttgcaaggattggccatcnnnnnnngtaactaacgaaaacaacagaagtgcctgtttaaacttgaaaacgtaacctttgcttttctaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55173885 |
tataagaaacttttgcaaggattggccatctttttttgtaattaacgaaaacaacagaagtgcctgtttaaacttgaaaacgtaacctttgcttttctaa |
55173984 |
T |
|
| Q |
101 |
gtttcatatattatttgttccggactagaccaaggcctacccaaactggacatctgcaacacaagctcggatccgaactgacgcgcctttcaattgaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55173985 |
gtttcatatattatttgttccggactagaccaaggcctacccaaactggacatctgcaacacaagctcggatccgaactgacgcgcctttcaattgaaat |
55174084 |
T |
|
| Q |
201 |
----ggtaattaaggggacaacat |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
55174085 |
ggtaggtaattaaggggacaacat |
55174108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University