View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16003_low_27 (Length: 363)
Name: NF16003_low_27
Description: NF16003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16003_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 18 - 353
Target Start/End: Complemental strand, 13348707 - 13348372
Alignment:
| Q |
18 |
atggacaggattcaatggaggagatccttactcagttggcttggatgcttcattggctgtcttgaacacacatgcttgcactgctactagcttgcttact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13348707 |
atggacaggattcaatggaggagatccttactcagttggcttggatgcttcattggctgtcttgaacacacatgcttgcactgctactagcttgcttact |
13348608 |
T |
|
| Q |
118 |
tgggtcttccttgatgtcattttcttcagaaagccttctgttattggtgctgttcaaggcatgattactggtttggtttgcattacccctgctgcaggtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13348607 |
tgggtcttccttgatgtcattttcttcagaaagccttctgttattggtgctgttcaaggcatgattactggtttggtttgcattacccctgctgcaggtt |
13348508 |
T |
|
| Q |
218 |
tgtaatatttcattcattcttcaagatannnnnnncccctttaaatccaatatatacgaggattattttgtacttgttttatattagttgatattttttc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| || |
|
|
| T |
13348507 |
tgtaatatttcattcattcttcaagatatttttttcccctttaaatccaatatttacgaggattattttgtacttgttttatattagttaatattttgtc |
13348408 |
T |
|
| Q |
318 |
acttataactaagagcgcttggatgatatggttcat |
353 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||| |
|
|
| T |
13348407 |
acttataactaagagcgcttggataagatggttcat |
13348372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 127 - 203
Target Start/End: Complemental strand, 39725594 - 39725518
Alignment:
| Q |
127 |
cttgatgtcattttcttcagaaagccttctgttattggtgctgttcaaggcatgattactggtttggtttgcattac |
203 |
Q |
| |
|
||||||||||| ||||||| ||| || || |||||||| |||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
39725594 |
cttgatgtcatattcttcaaaaaaccatcagttattggagctgttcaaggcatgattactggtcttgtttgcattac |
39725518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University