View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16003_low_33 (Length: 347)
Name: NF16003_low_33
Description: NF16003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16003_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 11 - 165
Target Start/End: Complemental strand, 40127339 - 40127185
Alignment:
| Q |
11 |
atcatcaatagtaaacctaatcaaagtagtactattatccattgaacccaacccagaaaccgaaacggactcaccgatattagcaccatgatccttacca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40127339 |
atcatcaatagtaaacctaatcaaagtagtactattatccattgaacccaacccagaaaccgaaacggactcaccgatattagcaccatgatccttacca |
40127240 |
T |
 |
| Q |
111 |
tccccaattgccttatcattaaatttcctataagcccaaaaccctataactatcg |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40127239 |
tccccaattgccttatcattaaatttcctataagcccaaaaccctataactatcg |
40127185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 211 - 331
Target Start/End: Complemental strand, 40127139 - 40127019
Alignment:
| Q |
211 |
tctttttcttactaccagatgaacttcctgaagtaaaatcaagttgaaataaacacttaacggtaccaggatcagacggtccaaattgatttgcaaaagc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40127139 |
tctttttcttactaccagatgaacttcctgaagtaaaatcaagttgaaataaacacttaacggtaccaggatcagacggtccaaattgatttgcaaaagc |
40127040 |
T |
 |
| Q |
311 |
tgcagcataaattgaaggata |
331 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40127039 |
tgcagcataaattgaaggata |
40127019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University