View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16003_low_44 (Length: 297)
Name: NF16003_low_44
Description: NF16003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16003_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 282
Target Start/End: Complemental strand, 21132617 - 21132334
Alignment:
| Q |
1 |
atgttaaaattcatgcaaattatacaatatttatatgccgtcttgcatagagaaatgataattgatgcaaattttagagtattctagattattttag--t |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
21132617 |
atgttaaaattcatgcaaattatacaatatttatatgccgtcttgcatagagaaatgataattgatgcaaattttagagtattctagattattttagagt |
21132518 |
T |
 |
| Q |
99 |
ctttggagtagaaatcttcaacacctatagatagacaatacatatgttattgacatggtggatgaggtagtgttcactctatattccaccactaatcatt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21132517 |
ctttggagtagaaatcttcaacacctatagatagacaatacatatgttattgacatggtggatgaggtagtgttcactctatattccaccactaatcatt |
21132418 |
T |
 |
| Q |
199 |
gtatggtccatagtcacataatctttatccacttgtcagctgcgaattggtgccttaattcacataccagtttgtggtactttt |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21132417 |
gtatggtccatagtcacataatctttatccacttgtcagctgcgaattggtgccttaattcgcataccagtttgtggtactttt |
21132334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University