View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16003_low_47 (Length: 294)
Name: NF16003_low_47
Description: NF16003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16003_low_47 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 14 - 278
Target Start/End: Original strand, 12011903 - 12012167
Alignment:
| Q |
14 |
gaacaagctttgaggagaaaagggaaagtgtgtttaccagggatagcaccgtgtctacgcatttgaatgtaaagggagagagaaatgcggggttgttgtt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |||| ||||||| |
|
|
| T |
12011903 |
gaacaagctttgaggagaaaagggaaagtgtgtttaccagggataacaccgtgtctacgcatttgaatgtaaagggaaagagaaatgtggggctgttgtt |
12012002 |
T |
 |
| Q |
114 |
gttgatgagcgcggatgagagtgttccacatgaatgaattgggtttgtgtaaggaggagaagattctagaagcgtgttcgaggttaccgaaaggggagag |
213 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
12012003 |
gttgatgcgcgcggatgagagtgttccacatgaatgaattgggtttgtgtaaggaggagaagattctagaagcgtgttcgaggttaccgaaaggggaaag |
12012102 |
T |
 |
| Q |
214 |
agcaaaagaggagaataaacggcttgtggcgaattggtcgttgatgcgggatgtgatgatcattt |
278 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12012103 |
agcgaaagaggagaataaacggcttgtggcgaattggtcgttgatgcgggatgtgatgatcattt |
12012167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University