View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16003_low_48 (Length: 292)
Name: NF16003_low_48
Description: NF16003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16003_low_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 18 - 281
Target Start/End: Complemental strand, 42702007 - 42701744
Alignment:
| Q |
18 |
caaggttatgcagttgaacatcacaaccagagatagctgcagcgtgaaactcaaatggcaccttgaagtgccgagcaagctttgataacctcttttcaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42702007 |
caaggttatgcagttgaacatcacaaccagagatagctgcagcgtgaaactcaaatggcaccttgaagtgccgagcaagctttgataacctcttttcaac |
42701908 |
T |
 |
| Q |
118 |
tatatgtagtccacctccacgggcataagctgatgtcggatcatcaatacctgtaatccggatgtgtggtggtcccccgggcctagctgcaaaagcctga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42701907 |
tatatgtagtccacctccacgggcataagctgatgtcggatcatcaatacctgtaatccggatgtgtggtggtcccccgggcctagctgcaaaagcctga |
42701808 |
T |
 |
| Q |
218 |
atcaacgaaatccattggcttccttgagcaatttggaaatcgattatatgaactctggcttcat |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42701807 |
atcaacgaaatccattggcttccttgagcaatttggaaatcgattatatgaactctggcttcat |
42701744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University