View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16003_low_53 (Length: 269)
Name: NF16003_low_53
Description: NF16003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16003_low_53 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 11 - 255
Target Start/End: Complemental strand, 30140852 - 30140608
Alignment:
| Q |
11 |
cataggccagcacttccattgtaaataccattcattctttcaatatataatctcttgtttcattttctttccacaaaataaccacctaattaagatggat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30140852 |
cataggccagcacttccattgtaaataccattcattctttcaatatataatctcttgtttcattttctttccacaaaataaccacctaattaagatggat |
30140753 |
T |
 |
| Q |
111 |
caagctagtacaattgaagctgaaccttcaatagtgttacatagcaaatccaagaaagtggtaaaatcaagagacaatagtgatgaatttgaaggatcaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30140752 |
caagctagtacaattgaagctgaaccttcaatagtgttacatagcaaatccaagaaagtggtaaaatcaagagacaatagtaatgaatttgaaggatcaa |
30140653 |
T |
 |
| Q |
211 |
taggagagaaaccatcaagatatgaagtttggggatggtatttgt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30140652 |
taggagagaaaccatcaagatatgaagtttggggatggtatttgt |
30140608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University