View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16003_low_57 (Length: 260)
Name: NF16003_low_57
Description: NF16003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16003_low_57 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 19 - 250
Target Start/End: Complemental strand, 3945384 - 3945152
Alignment:
| Q |
19 |
gaatggaagtgagaaaggaatgaagaaagatgaaggagagatggagcatgtgggtggtttgtatgatccagctgcttcttcactttactggaatacagca |
118 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3945384 |
gaatggaagtgagaaaggaacgaagaaagatgaaggagagatggagcatgtgggtggtttgtatgatccagctgcttcttcactttactggaatacagca |
3945285 |
T |
 |
| Q |
119 |
tcatcatcagctattggtgtttggaacgatcaagcttctaatattggttcatcagttacttctttgatctagagtgaacaataaacttaatcctcagttc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3945284 |
tcatcatcagctattggtgtttggaacgatcaagcttctaatattggttcatcagttacttctttgatctagagtgaacaataaactcaatcctcagttc |
3945185 |
T |
 |
| Q |
219 |
aagttcaaggtcatc-ttaatttggtacctttg |
250 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
3945184 |
aagttcaaggtcatctttaatttggtacctttg |
3945152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University