View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16003_low_61 (Length: 240)
Name: NF16003_low_61
Description: NF16003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16003_low_61 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 9645073 - 9644853
Alignment:
| Q |
1 |
atcagcattggttttaacactgcctgtgttcacctgtatctcattttctttttcaccaccatcagaaaatttgttttttgacgcccatataccttttttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9645073 |
atcagcattggttttaacactgcctgtgttcacctgtatctcattttctttttcaccaccatcagaaaatttgttttttgacgcccatataccttttttc |
9644974 |
T |
|
| Q |
101 |
aacacattttctgtagaaccatatttcattttggttatgctacccggttttcggttcccagccatactgtctatgttgccttttatgtttgccttttgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9644973 |
aacacattttctgtagaaccatatttcattttggttatgctacccggttttcggttcccagccatactttctatgttgccttttatgtttgccttttgga |
9644874 |
T |
|
| Q |
201 |
acaaagttcttccaacggtag |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9644873 |
acaaagttcttccaacggtag |
9644853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 24 - 132
Target Start/End: Complemental strand, 56008366 - 56008258
Alignment:
| Q |
24 |
ctgtgttcacctgtatctcattttctttttcaccaccatcagaaaatttgttttttgacgcccatataccttttttcaacacattttctgtagaaccata |
123 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| || ||| || |||| | |||||| | ||| ||||||| ||||||| |||| ||| |
|
|
| T |
56008366 |
ctgtgttcacctgtatctcattttccttttcaccaccatcagcaactttacttcttgaagtccatatccttttcttcaacatgttttctgcagaagtata |
56008267 |
T |
|
| Q |
124 |
tttcatttt |
132 |
Q |
| |
|
||||||||| |
|
|
| T |
56008266 |
tttcatttt |
56008258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University