View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16003_low_66 (Length: 228)
Name: NF16003_low_66
Description: NF16003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16003_low_66 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 81 - 228
Target Start/End: Complemental strand, 36552112 - 36551964
Alignment:
| Q |
81 |
atttacaaataaatatccattttcttccactagaacatcaatgaaagctcaaacacgaaaccttcatatcgttttt-accattagataaacttttgaagt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36552112 |
atttacaaataaatatccattttcttccactagaacatcaatgaaagctcaaacacggaaccttcatatcgttttttaccattagataaacttttgaagt |
36552013 |
T |
|
| Q |
180 |
tatacataattacatacacttatttttcacattatttttaaccacgttt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36552012 |
tatacataattacatacacttatttttcacattatttttaaccacgttt |
36551964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 7 - 84
Target Start/End: Complemental strand, 36552209 - 36552133
Alignment:
| Q |
7 |
aactgcttcttttcagtagtttcttcgatatatcttatgctaaggagaccacttttgctgtgttagtatcatcaattt |
84 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
36552209 |
aactgcttcttttcagtagtttcttcggcatatcttgtgctaaggagacca-ttttgcagtgttagtatcatcaattt |
36552133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University