View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16004_high_14 (Length: 258)
Name: NF16004_high_14
Description: NF16004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16004_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 18 - 244
Target Start/End: Complemental strand, 23854587 - 23854354
Alignment:
| Q |
18 |
aagaatacaagaagaactcgagaagtataccaaaatgttgcaaccctagggagaaaatggacaactatattt-----tctccttataaactaaactaaac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23854587 |
aagaatacaagaagaactcgagaagtataccaaaatgttgcaaccctagggagaaaatggacaactatatttgattttctccttataaactaaactaaac |
23854488 |
T |
|
| Q |
113 |
cacaatgtttagttttgaagctaaaatatccctattttaagacttctcctgaccataaattgctgat-nnnnnnnnnnccgagatcaatttcaaactctt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23854487 |
cacaatgtttagttttgaagctaaaatatccctattttaagacttctcctgaccataaattgctgataaaaaaaaaaaccgagatcaatttcaaactctt |
23854388 |
T |
|
| Q |
212 |
attccaatcaatt-aaattgctgtagtttataat |
244 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
23854387 |
attccaatcaattaaaattgctgtagtttataat |
23854354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University