View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16004_low_16 (Length: 306)
Name: NF16004_low_16
Description: NF16004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16004_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 78; Significance: 2e-36; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 50 - 131
Target Start/End: Complemental strand, 25605271 - 25605190
Alignment:
| Q |
50 |
ttgtttctaaattcatgagcatatgtcatgttgtattataaccacagttatgaatgaaatgaattagctgtgatttattttt |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25605271 |
ttgtttctaaattcatgagcatatgtcatgttgtattataaccacagttatgaatgaaatgaattagctgtgttttattttt |
25605190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 241 - 285
Target Start/End: Complemental strand, 25605073 - 25605029
Alignment:
| Q |
241 |
catttttatcctctatcatatcctagatttcaaaaagattatgta |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25605073 |
catttttatcctctatcatatcctagatttcaaaaagattatgta |
25605029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 141 - 176
Target Start/End: Complemental strand, 25605173 - 25605138
Alignment:
| Q |
141 |
tgcatctatatgtaatataggagtatagtaactatc |
176 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25605173 |
tgcatccatatgtaatataggagtatagtaactatc |
25605138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University