View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16004_low_9 (Length: 342)
Name: NF16004_low_9
Description: NF16004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16004_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 14 - 327
Target Start/End: Complemental strand, 12840014 - 12839703
Alignment:
| Q |
14 |
atttggttcatgacagtacacgacacttaaaatatcacagctataattaaaaaccattcgtatatgattaccgacaacttgctttacaggttgtttcatc |
113 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
12840014 |
atttggttcatgacagtacgcgacacttaaaatatcacagctataattaaaaaccattcgtatatgattacggacaacttactttacaggttgtttcatc |
12839915 |
T |
|
| Q |
114 |
gtgtgcaaaacttgacagtgctccatttgcaattgcatatgtcattcttcacattacatctcaggtacaccatgtttaatctctagcctctcggctttat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12839914 |
gtgtgcaaaacttgacagtgctccatttacaattgcatatgtcatt--tcacattacatctcaggtacaccatgtttaatctctagcctctcggctttat |
12839817 |
T |
|
| Q |
214 |
taggacttaggaggatggaggcggtatataattaagctttcaaggaagcatagaatgaatatgaatgtttatggtgtttcaactgtttttcatttgtaag |
313 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12839816 |
taggacttaggaggatggaagcggtatataattaagctttcaaggaagcatagaatgaatatgaatgtttatggtgtttcaactgtttttcatttgtaag |
12839717 |
T |
|
| Q |
314 |
gtaggtcccatatg |
327 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
12839716 |
gtaggtcccatatg |
12839703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 86 - 205
Target Start/End: Original strand, 39177910 - 39178029
Alignment:
| Q |
86 |
gacaacttgctttacaggttgtttcatcgtgtgcaaaacttgacagtgctccatttgcaattgcatatgtcattcttcacattacatctcaggtacacca |
185 |
Q |
| |
|
|||||| | ||||||||||||||| || ||||||| | || |||||||| ||||||||||| | ||||||| ||| |||||||||||||||||| || |
|
|
| T |
39177910 |
gacaacatactttacaggttgttttgtcctgtgcaagccctgctagtgctccctttgcaattgcctctgtcattgttctcattacatctcaggtacatca |
39178009 |
T |
|
| Q |
186 |
tgtttaatctctagcctctc |
205 |
Q |
| |
|
|||||| | ||||||||||| |
|
|
| T |
39178010 |
tgtttattgtctagcctctc |
39178029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 198
Target Start/End: Original strand, 39199342 - 39199375
Alignment:
| Q |
165 |
cattacatctcaggtacaccatgtttaatctcta |
198 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
39199342 |
cattacatctcaggtacaccgtgtttaatctcta |
39199375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University