View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16005_high_4 (Length: 347)
Name: NF16005_high_4
Description: NF16005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16005_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 19 - 337
Target Start/End: Original strand, 11180893 - 11181227
Alignment:
| Q |
19 |
gttgagttgagagaataaaaatcaaaattggaattgaaacaagatttccaacaatgttgtcaaaggaacagctatttgtagtatagactagaaaggcacc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11180893 |
gttgagttgagagaataaaaatcaaaattggaattgaaacaagatttccaacaatgttgtcaaaggaacagctatttgtagtatagactagaaaggcacc |
11180992 |
T |
|
| Q |
119 |
ctcggnnnnnnnggtgtttctgtatct----------------atcacctgcatctgcatgcactattgtgttctgtttttactattgttttgtttgaat |
202 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11180993 |
ctcggtttttttggtgtttctgtatctatcacctgcgtgatctatcacctgcatctgcatgcactattgtgttctgtttttactattgctttgtttgaat |
11181092 |
T |
|
| Q |
203 |
gccctggacctgtcctgtcccaaacaaaccccgcaggtgaaattctctatagttttcttgttccgcatgtcactcctagtgttactttttctaccgtcta |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11181093 |
gccctggacctgtcctgtcccaaacaaaccccgcaggtgaaattctctatagttttcttgttccgcatgtcactcctagtgttactttttctactgtcta |
11181192 |
T |
|
| Q |
303 |
ttttgaacatgtataaacccgtgacactacctatg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
11181193 |
ttttgaacatgtataaacccgtgacactacctatg |
11181227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University