View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16005_high_7 (Length: 303)
Name: NF16005_high_7
Description: NF16005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16005_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 286
Target Start/End: Complemental strand, 11536261 - 11535976
Alignment:
| Q |
1 |
ctaataatactccactgatttgtggtcttacagatgatatttctcttttgtgtctggaaagagtgcctagaaaatatcattcggtcctgaaggctgtttc |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11536261 |
ctaataatactccattgatttgtggtcttccagatgatatttctcttttgtgtctggcaagagtgcctagaaaatatcattcggtcctgaaggctgtttc |
11536162 |
T |
|
| Q |
101 |
aaaaagatggaaggacttagtttgcagcgaagagtggctttattatcgtagaaagcataaacttgatgagacgtggatctatgctttgtgcagggataaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11536161 |
aaaaagatggaaggacttagtttgcagcgaagagtggctttattatcgtagaaagcataaacttgatgagacgtggatctatgctttgtgcagggataaa |
11536062 |
T |
|
| Q |
201 |
ttggatcatgtttactgctatgttttggatcctacctcgtcaagaaaatcctggaagctcattcatggggttccgcctcacgtaat |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11536061 |
ttggatcatgtttactgctatgttttggatcctacctcgtcaagaaaatcctggaagctcattcatggggttccacctcacgtaat |
11535976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University