View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16005_low_12 (Length: 227)

Name: NF16005_low_12
Description: NF16005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16005_low_12
NF16005_low_12
[»] chr2 (1 HSPs)
chr2 (14-213)||(40452664-40452861)


Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 14 - 213
Target Start/End: Original strand, 40452664 - 40452861
Alignment:
14 atcataccttgctgttgctgctgatttccatctttttctttttaaacatagttatatgttcttaatttgnnnnnnnnnnnnnnnnnntcagaacaacact 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                  |||||||||||||    
40452664 atcataccttgctgttgctgctgatttccatctttttctttttaaacatagttatatgttcttaatttgaaaaagaaaaaaaaaa--tcagaacaacact 40452761  T
114 tataaataattaaataattaggcgattggttgattgtaaatgaaaatgaatcataccttgctgcctgagtgagagctgcgcagtgtgttgacttggtatt 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
40452762 tataaataattaaataattaggcgattggttgattgtaaatgaaaatgaatcataccttgctgcctgagtgagagctgcgcagtgtgttgactttgtatt 40452861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University