View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16005_low_12 (Length: 227)
Name: NF16005_low_12
Description: NF16005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16005_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 14 - 213
Target Start/End: Original strand, 40452664 - 40452861
Alignment:
| Q |
14 |
atcataccttgctgttgctgctgatttccatctttttctttttaaacatagttatatgttcttaatttgnnnnnnnnnnnnnnnnnntcagaacaacact |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40452664 |
atcataccttgctgttgctgctgatttccatctttttctttttaaacatagttatatgttcttaatttgaaaaagaaaaaaaaaa--tcagaacaacact |
40452761 |
T |
 |
| Q |
114 |
tataaataattaaataattaggcgattggttgattgtaaatgaaaatgaatcataccttgctgcctgagtgagagctgcgcagtgtgttgacttggtatt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40452762 |
tataaataattaaataattaggcgattggttgattgtaaatgaaaatgaatcataccttgctgcctgagtgagagctgcgcagtgtgttgactttgtatt |
40452861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University