View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_high_24 (Length: 357)
Name: NF16006_high_24
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_high_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 20 - 345
Target Start/End: Original strand, 18319753 - 18320078
Alignment:
| Q |
20 |
cgtcaaactcgcttcaaccgttttcgttcgttacacttcattcgaccgtttcattttttattttagcaaacatttaactccaaatctcgttcaagagatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18319753 |
cgtcaaactcgcttcaaccgttttcgttcgttacacttcattcgaccgtttcattttttattttagtaaacatttaactccaaatctcgttcaagagatt |
18319852 |
T |
|
| Q |
120 |
gttaattctaggtttaacaaaactcctttgttaggttttagggttgttgaatttactaaagagaaattgcatatgaatcataattattggacttataata |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18319853 |
gttaattctaggtttaacaaaactcctttgttaggttttagggttgttgaattcactaaagagaaattgcatatgaatcataattattggacttataata |
18319952 |
T |
|
| Q |
220 |
tgcttttgagatcgctttgtgaaacgaatcatcatcgttccgcgaaattggtttatgattggatgagatttgatgggcaggttcctgatagttggttgtt |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18319953 |
tgcttttgagatcgctttgtgaaacgaatcatcatcgttccgcgaaattggtttacgattggatgagatttgatgggcaggttcctgatagttggttgtt |
18320052 |
T |
|
| Q |
320 |
agggtttttggtttcgtcctatgctt |
345 |
Q |
| |
|
|||||||||||||||||| ||||||| |
|
|
| T |
18320053 |
agggtttttggtttcgtcgtatgctt |
18320078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University