View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_high_30 (Length: 325)
Name: NF16006_high_30
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_high_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 315
Target Start/End: Complemental strand, 4980816 - 4980502
Alignment:
| Q |
1 |
ttaatttatattttttaccctttgtttatttgtctactnnnnnnngtaatacttctaaactccataaaggcataaagccacatttcatttcatttcattt |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4980816 |
ttaatttattttttttaccctttgtttatttgtctactaaaaaaagtaatacttctaaactccataaaggcataaagccacatttcatttcatttcattt |
4980717 |
T |
 |
| Q |
101 |
tcatactaatgaataactcaactaatatatcttcaacatgagcctctatgcaatgatcacaggctcacagctcattctgcacctacccactcagttttta |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4980716 |
tcatactaatgaatgactcaactaatatatcttcaacatgagcctctatgcaatgatcacaggctcacagctcattctgcacctacccactcagttttta |
4980617 |
T |
 |
| Q |
201 |
ccagtcacattacccaacctcaatttgtgtgttattgtgtgtccctctcactatacctgtcactgatcccataggaaaccaaggctatccttgatgttta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4980616 |
ccagtcacattacccaacctcaatttgtgtgttattgtgtgtccctctcactatacctgtcactgatcccataggaaaccaaggctatccttgatgttta |
4980517 |
T |
 |
| Q |
301 |
cattgctcctctgtg |
315 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4980516 |
cattgctcctctgtg |
4980502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University