View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_high_39 (Length: 304)
Name: NF16006_high_39
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_high_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 162
Target Start/End: Complemental strand, 27321651 - 27321490
Alignment:
| Q |
1 |
tatatgctatcaacatgcccctttttatcaatcgattatagtatgatggtaaatttcatttcaaaaagataattttttgcataatttgttctttacgtgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27321651 |
tatatgctatcaacatgcccctttttatcaatcgattctagtatgatggtaaatttcatttcaaaaagataattttttgcataatttgttctttacgtgg |
27321552 |
T |
 |
| Q |
101 |
aaatctttgtttggttgattaatatgtagggcaaatttactatgcgcaaaaagatacacata |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27321551 |
aaatctttgtttggttgattaatatgtagggcaaatttactatgcgcaaaaagatacacata |
27321490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 183 - 252
Target Start/End: Complemental strand, 27321501 - 27321432
Alignment:
| Q |
183 |
aagatacacatatttattgtttatcatcattttctctcatatcatattactacatatattaatcatctta |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27321501 |
aagatacacatatttattgtttatcatcattttctctcatatcatattactacatatattaatcatctta |
27321432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 23 - 115
Target Start/End: Original strand, 37746547 - 37746638
Alignment:
| Q |
23 |
ttttatcaatcgattatagtatgatggtaaatttcatttcaaaaagataattttttgcataatttgttctttacgtggaaatctttgtttggt |
115 |
Q |
| |
|
||||||||||| ||| |||||||| ||||||||| ||||||||||||| | ||||||| |||||| ||||| |||||||| |||||||||| |
|
|
| T |
37746547 |
ttttatcaatcaattcaagtatgattttaaatttcagttcaaaaagataaatatttgcatgatttgtgcttta-gtggaaatatttgtttggt |
37746638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University