View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_high_41 (Length: 291)
Name: NF16006_high_41
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_high_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 2 - 278
Target Start/End: Original strand, 9166225 - 9166513
Alignment:
| Q |
2 |
aaggtcccctccccttggaccttcatcgtcatcatagccacnnnnnnnattcagtccatgtctgttcttcttatctacttcctcatcttcatcttcctct |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9166225 |
aaggtcccctccccttggaccttcatcgtcatcatagccactttttttattcagtccatgtctattcttcttatctacttcctcatcttcatcttcctct |
9166324 |
T |
 |
| Q |
102 |
cctttatcagaggaagga------------tcatcaccagnnnnnnnacggcttctcccaccacctgcgttgctttctttgtcatctaacttccaatgtt |
189 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9166325 |
cctttatcagaggaaggaccttcatcatcatcatcaccagtttttttacggcttctcccaccacctgcgttgctttctttgtcatctaacttccaatgtt |
9166424 |
T |
 |
| Q |
190 |
caccaaatgcagcaggaccattatttgctgctttcatcatccatctttgatatccatcagcagtctttttcctattattcatcttctct |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9166425 |
caccaaatgcagcaggaccattatttgctgctttcatcatccatctttgatatccatcagcagtctttttcctattattcatcttctct |
9166513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 61 - 278
Target Start/End: Original strand, 9154867 - 9155096
Alignment:
| Q |
61 |
gtctgttcttcttatctacttcctcatcttcatcttcctctcctttatcagaggaagga------------tcatcaccagnnnnnnnacggcttctccc |
148 |
Q |
| |
|
|||| |||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| ||||| |||||| |
|
|
| T |
9154867 |
gtcttttcttcctatctacttcctcgtcttcatcttcctctcctttatcagaggaaggaccttcatcttcatcatcaccagtctttttacggcctctccc |
9154966 |
T |
 |
| Q |
149 |
accacctgcgttgctttctttgtcatctaacttccaatgttcaccaaatgcagcaggaccattatttgctgctttcatcatccatctttgatatccatca |
248 |
Q |
| |
|
||| ||||||||||| || |||||||||||||||| ||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9154967 |
accccctgcgttgctctccttgtcatctaacttcccatgttcaccaaatgcagcaggcccattgtttgctgctttcatcatccatctttgatatccatca |
9155066 |
T |
 |
| Q |
249 |
gcagtctttttcctattattcatcttctct |
278 |
Q |
| |
|
||||| ||||||||||| |||||||||||| |
|
|
| T |
9155067 |
gcagtttttttcctatttttcatcttctct |
9155096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University