View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_high_44 (Length: 282)
Name: NF16006_high_44
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_high_44 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 275
Target Start/End: Complemental strand, 40064690 - 40064416
Alignment:
| Q |
1 |
cttaaacttgcattgcctttgattgtcgctgcggtaactgtaaccttgctcgaagaaacttagattgtagtatttgtagattctatgcaacctttctaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40064690 |
cttaaacttgcattgcctttgattgtcgctgcggtaactgtaaccttgctcgaagaaacttagattgtagtatttgtagattctatgcaacctttctaca |
40064591 |
T |
 |
| Q |
101 |
tgagattgagtttcacaaaggttacttctaaactgggaaactatctcatatggtttatggtggattgatgcttgaaattgtttgaaactatacaacaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40064590 |
tgagattgagtttcacaaaggttacttctaaaatgggaaactatctcatatggtttatggtggattgatgcttgaaattgttcgaaactatacaacaact |
40064491 |
T |
 |
| Q |
201 |
ggtgccgctgccaataagtagaaactcatggtattacatgtccctacaattgaaacagtgatccaatctgtgctg |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
40064490 |
ggtgccgctgccaataagtagaaactcatggtattacatgtccgtacaattgaaacagtgatccaatcggtgctg |
40064416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University