View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_high_49 (Length: 273)
Name: NF16006_high_49
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_high_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 24 - 236
Target Start/End: Original strand, 35405883 - 35406095
Alignment:
| Q |
24 |
cttctctcttattattcctcacacaaattttccctttgttcaatcccaaacaaagccaaaaattaaatcgttcaaactgcatgtagcagcacttcatcaa |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35405883 |
cttctctcttattattcctcacacaaattttccctttgttcaatcccaaacaaagccaaaaattaaatcgttcaaactgcatgcagcagcacttcatcaa |
35405982 |
T |
 |
| Q |
124 |
taatatcatgcaccatcatcaatacatgaatcaaatgcatattcagacaatgatgatttgatgctgaaagttcaaaagagtctctgagcaacaccttaat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35405983 |
taatatcatgcaccatcatcaatacatgaatcaaatgcatattcagacaatgatgatttgatgctgaaagttcaaaagagtctctgagcaacaccttaat |
35406082 |
T |
 |
| Q |
224 |
taattcatctcac |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35406083 |
taattcatctcac |
35406095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University