View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_high_51 (Length: 272)
Name: NF16006_high_51
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_high_51 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 21482528 - 21482276
Alignment:
| Q |
1 |
ttccttctacaaaaggttttgaagcaaagtgatgtcggaagtctggggagaattgttttgccaaaagtaattatagattttctatttatctattatttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |||||| | |
|
|
| T |
21482528 |
ttccttctacaaaaggttttgaagcaaagtgatgtcggaagtctggggagaattgttttgccaaaagtaattattgattttctatttttcaattattca- |
21482430 |
T |
 |
| Q |
101 |
ttacattttatgagaaac-aaattattgattcataatgttattgcaaaaacatcagaaagaggcagaaacacatttgccagaattggaggcgagagatgg |
199 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21482429 |
ttacattttatgagaaaataaaatattgattcatagt-ttattgcaaaaacatcagaaagaggcagaaacacatttgccagaattggaggcaagagatgg |
21482331 |
T |
 |
| Q |
200 |
aatttcgattacaatggaagacattggaacttctcgagtttggaatatgcgttat |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21482330 |
aatttcgattacaatggaagacattggaacttctcgagtttggaatatgcgttat |
21482276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University