View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16006_high_55 (Length: 259)

Name: NF16006_high_55
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16006_high_55
NF16006_high_55
[»] chr5 (4 HSPs)
chr5 (17-244)||(13879740-13879965)
chr5 (17-140)||(13875517-13875640)
chr5 (214-244)||(13875730-13875760)
chr5 (104-140)||(13885720-13885756)


Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 17 - 244
Target Start/End: Original strand, 13879740 - 13879965
Alignment:
17 taggagatggcaaccagagacatggcggcagtagcgaaggggcggtggcgaatgaatgcaggcacggcggacatgaaagagtggtaagaggaagaaagga 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13879740 taggagatggcaaccagagacatggcggcagtagcgaaggggcggtggcgaatgaatgcaggcacggcggacatgaaagagtggtaagaggaagaaagga 13879839  T
117 ggcgggaaaatgccattgtgttgacagttgacagagtgagattttcttgggattgctttctctctttatcgcttgcttttagggtttttgtagtgaaaaa 216  Q
    |||||||||||||||||||||| |||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13879840 ggcgggaaaatgccattgtgttaacagttgac--agtgagattttcttgggattgctttctctctttatcgcttgcttttagggtttttgtagtgaaaaa 13879937  T
217 tggcttaagaatgttctagaaggatact 244  Q
    |||||| |||||||||||||||||||||    
13879938 tggctttagaatgttctagaaggatact 13879965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 17 - 140
Target Start/End: Original strand, 13875517 - 13875640
Alignment:
17 taggagatggcaaccagagacatggcggcagtagcgaaggggcggtggcgaatgaatgcaggcacggcggacatgaaagagtggtaagaggaagaaagga 116  Q
    ||||||||||| || || ||||||||||||||||||| |||| || ||||||||| || ||||||||||| |||||| ||| ||||  ||||||| ||||    
13875517 taggagatggctacgagtgacatggcggcagtagcgacggggtggcggcgaatgagtgaaggcacggcggccatgaatgagcggtagcaggaagagagga 13875616  T
117 ggcgggaaaatgccattgtgttga 140  Q
    ||||||||||||||||||||||||    
13875617 ggcgggaaaatgccattgtgttga 13875640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 244
Target Start/End: Original strand, 13875730 - 13875760
Alignment:
214 aaatggcttaagaatgttctagaaggatact 244  Q
    |||||||||||||||||||||||||||||||    
13875730 aaatggcttaagaatgttctagaaggatact 13875760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 140
Target Start/End: Original strand, 13885720 - 13885756
Alignment:
104 gaggaagaaaggaggcgggaaaatgccattgtgttga 140  Q
    |||||||| |||| |||||||||||||||||||||||    
13885720 gaggaagagaggaagcgggaaaatgccattgtgttga 13885756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University