View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_high_64 (Length: 250)
Name: NF16006_high_64
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_high_64 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 41175317 - 41175538
Alignment:
| Q |
18 |
acctcttttttattttctactttacacttatgggaatctatgtgaggtagtggtagtatttatatacgggttaccactgtcttgatttgttttg-----t |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41175317 |
acctcttttttattttctactttacacttatgggaatctatgtgaggtagtggtagtatttatatacgggttaccactgtcttgatttgttttaattttt |
41175416 |
T |
 |
| Q |
113 |
tataaaattatataacacaataataagtgactttgcatatcaaccgtacaagtggttccgcatgctcagttgctcattcaatcaattgctatgagacaat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41175417 |
tataaaattatataacacaataataagtgactttgcatatcaaccgtacaagtggttccgcatgctcagttgctcattcaatcaattgctatgagacaat |
41175516 |
T |
 |
| Q |
213 |
tctggaggacaatgacatccat |
234 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41175517 |
tctggaggacaatgacatccat |
41175538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University