View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_high_73 (Length: 240)
Name: NF16006_high_73
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_high_73 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 14 - 119
Target Start/End: Complemental strand, 42206803 - 42206698
Alignment:
| Q |
14 |
agataaaagttgattttcaatttcattacatgactggatttttatgaaattaataactatttttccataaaatatgtagtatttattttgatttactact |
113 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42206803 |
agataaaagtagattttcaatttcattacatgactggatttttatgaaattaataactatttttccataaaatatgtagtatttattttgatttactact |
42206704 |
T |
|
| Q |
114 |
agctct |
119 |
Q |
| |
|
|||||| |
|
|
| T |
42206703 |
agctct |
42206698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 165 - 240
Target Start/End: Complemental strand, 42205928 - 42205853
Alignment:
| Q |
165 |
ccccatgccccaaattattcaaattgaaatgctagtatgagagaaacatagagaataggggtagagatttcatgat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42205928 |
ccccatgccccaaattattcaaattgaaatgctagtatgagagaaacatagagaataggggtagagatttcatgat |
42205853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University