View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_high_76 (Length: 235)
Name: NF16006_high_76
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_high_76 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 35473836 - 35474057
Alignment:
| Q |
1 |
aaatgatggaggtggttcttctgcaacgacgacgac---gacaaccacgatcgatgatgccaaccctagggctaaaactgataggtccaagactctcatt |
97 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35473836 |
aaatgatggaggtggttcttctgcaacaacaacgacaacgacaaccacgatcgatgatgccaaccctagggctaaaactgataggtccaagactctcatt |
35473935 |
T |
|
| Q |
98 |
tctgagagaaggaggagaggcaggatgaaggataagctttatgcattgcgttctttggttcccaacattacaaaggtaattagtatcctttttcaattaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35473936 |
tctgagagaaggaggagaggcaggatgaaggataagctttatgcattgcgttctttggttcccaacattacaaaggtaattagtatcctttttcaattaa |
35474035 |
T |
|
| Q |
198 |
tttcgaactctataactcctgc |
219 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35474036 |
tttcgaactctataactcctgc |
35474057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 71 - 175
Target Start/End: Complemental strand, 20952002 - 20951898
Alignment:
| Q |
71 |
aaaactgataggtccaagactctcatttctgagagaaggaggagaggcaggatgaaggataagctttatgcattgcgttctttggttcccaacattacaa |
170 |
Q |
| |
|
|||| |||||| ||||||||| | |||||||||| |||||| || || | ||||||||||||||||| ||||||||||||||||||||||| || || | |
|
|
| T |
20952002 |
aaaaatgatagatccaagactttggtttctgagaggaggaggcgaagccgaatgaaggataagctttacgcattgcgttctttggttcccaatataacta |
20951903 |
T |
|
| Q |
171 |
aggta |
175 |
Q |
| |
|
||||| |
|
|
| T |
20951902 |
aggta |
20951898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 122 - 170
Target Start/End: Complemental strand, 20947774 - 20947726
Alignment:
| Q |
122 |
atgaaggataagctttatgcattgcgttctttggttcccaacattacaa |
170 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||| |||| |
|
|
| T |
20947774 |
atgaaggataagatttatgcattacgttctttggttcccaacataacaa |
20947726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University