View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_high_77 (Length: 235)
Name: NF16006_high_77
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_high_77 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 219
Target Start/End: Original strand, 35473625 - 35473828
Alignment:
| Q |
16 |
atgaagatgcaatatctaactttggttctgaccttatcaatgattgcttcattgataataatattaaccaatttctttcaattcctccaaacccattatt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
35473625 |
atgaagatgcaatatctaactttggttctgaccttatcaatgattgcttcattgataataatattaaccaacttctttcaattcctccaaatccattatt |
35473724 |
T |
 |
| Q |
116 |
tgatcacaacaacaatattattaataataatgttgttaatgagtataatccaagccctacaacaattggctccttctcttgttatgatggagtgattaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35473725 |
tgatcacaacaacaatattattaataataatgttgttaatgagtataatccaagccctacaacaattggctccttctcttgttatgatggagtgattaaa |
35473824 |
T |
 |
| Q |
216 |
ggag |
219 |
Q |
| |
|
|||| |
|
|
| T |
35473825 |
ggag |
35473828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University