View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16006_high_84 (Length: 225)

Name: NF16006_high_84
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16006_high_84
NF16006_high_84
[»] chr3 (1 HSPs)
chr3 (1-216)||(51018483-51018698)
[»] chr1 (1 HSPs)
chr1 (64-170)||(8810322-8810428)


Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 51018483 - 51018698
Alignment:
1 tcactatttctttgatcgttgcaacgtggtgaagtgtttgatcgattctcttcgtgaaactgcgatggtgaatcctttggttgaacgtgccaccagcgac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51018483 tcactatttctttgatcgttgcaacgtggtgaagtgtttgatcgattctcttcgtgaaactgcgatggtgaatcctttggttgaacgtgccaccagcgac 51018582  T
101 ttcctcattggtcctgattgggctttgaatctcgagatctgtgatgtactcaatcgtgatcccgggtacgaaactaccgattgcgttggcatttgaattt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
51018583 ttcctcattggtcctgattgggctttgaatctcgagatctgtgatgtactcaatcgtgatcccgggtacgaaactaccaattgcgttggcatttgaattt 51018682  T
201 taaatcttgttcttct 216  Q
    ||||||||||||||||    
51018683 taaatcttgttcttct 51018698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 64 - 170
Target Start/End: Complemental strand, 8810428 - 8810322
Alignment:
64 gatggtgaatcctttggttgaacgtgccaccagcgacttcctcattggtcctgattgggctttgaatctcgagatctgtgatgtactcaatcgtgatccc 163  Q
    |||||||||| || |||||||||| ||||| |||||  | ||||| ||||| ||||||||| ||||| |||||||||||||  | ||||||| ||| ||     
8810428 gatggtgaattctatggttgaacgcgccacgagcgatatgctcatcggtcccgattgggctatgaatatcgagatctgtgacatgctcaatcatgaccct 8810329  T
164 gggtacg 170  Q
    |||||||    
8810328 gggtacg 8810322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University