View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_low_101 (Length: 225)
Name: NF16006_low_101
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_low_101 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 51018483 - 51018698
Alignment:
| Q |
1 |
tcactatttctttgatcgttgcaacgtggtgaagtgtttgatcgattctcttcgtgaaactgcgatggtgaatcctttggttgaacgtgccaccagcgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51018483 |
tcactatttctttgatcgttgcaacgtggtgaagtgtttgatcgattctcttcgtgaaactgcgatggtgaatcctttggttgaacgtgccaccagcgac |
51018582 |
T |
|
| Q |
101 |
ttcctcattggtcctgattgggctttgaatctcgagatctgtgatgtactcaatcgtgatcccgggtacgaaactaccgattgcgttggcatttgaattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51018583 |
ttcctcattggtcctgattgggctttgaatctcgagatctgtgatgtactcaatcgtgatcccgggtacgaaactaccaattgcgttggcatttgaattt |
51018682 |
T |
|
| Q |
201 |
taaatcttgttcttct |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
51018683 |
taaatcttgttcttct |
51018698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 64 - 170
Target Start/End: Complemental strand, 8810428 - 8810322
Alignment:
| Q |
64 |
gatggtgaatcctttggttgaacgtgccaccagcgacttcctcattggtcctgattgggctttgaatctcgagatctgtgatgtactcaatcgtgatccc |
163 |
Q |
| |
|
|||||||||| || |||||||||| ||||| ||||| | ||||| ||||| ||||||||| ||||| ||||||||||||| | ||||||| ||| || |
|
|
| T |
8810428 |
gatggtgaattctatggttgaacgcgccacgagcgatatgctcatcggtcccgattgggctatgaatatcgagatctgtgacatgctcaatcatgaccct |
8810329 |
T |
|
| Q |
164 |
gggtacg |
170 |
Q |
| |
|
||||||| |
|
|
| T |
8810328 |
gggtacg |
8810322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University