View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16006_low_102 (Length: 223)

Name: NF16006_low_102
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16006_low_102
NF16006_low_102
[»] chr7 (1 HSPs)
chr7 (1-208)||(44798514-44798721)


Alignment Details
Target: chr7 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 44798721 - 44798514
Alignment:
1 ttggtttatttatggtctcttaattctcaacaaaaatactcaattcgtgatgtatatcctttcagcctgcttatcctattggccagccaatttatnnnnn 100  Q
    |||| |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||         
44798721 ttggcttatttatggtctcttcattctcaacaaaaatactcaattcgtgatatatatcctttcagcctgcttatcctattggccagccaatttataaaaa 44798622  T
101 nnnnnntcatgagactatacattgtttggacttttcagggataagtacagtgaacaaaaataatttattttagcaaatagtcaaagaacaaaactcttaa 200  Q
          ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44798621 aaaaaatcatgagacgatacattgtttggacttttcagggataagtacagtgaacaaaaataatttattttagcaaatagtcaaagaacaaaactcttaa 44798522  T
201 cacctatg 208  Q
    ||||||||    
44798521 cacctatg 44798514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University