View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_low_102 (Length: 223)
Name: NF16006_low_102
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_low_102 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 44798721 - 44798514
Alignment:
| Q |
1 |
ttggtttatttatggtctcttaattctcaacaaaaatactcaattcgtgatgtatatcctttcagcctgcttatcctattggccagccaatttatnnnnn |
100 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44798721 |
ttggcttatttatggtctcttcattctcaacaaaaatactcaattcgtgatatatatcctttcagcctgcttatcctattggccagccaatttataaaaa |
44798622 |
T |
|
| Q |
101 |
nnnnnntcatgagactatacattgtttggacttttcagggataagtacagtgaacaaaaataatttattttagcaaatagtcaaagaacaaaactcttaa |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44798621 |
aaaaaatcatgagacgatacattgtttggacttttcagggataagtacagtgaacaaaaataatttattttagcaaatagtcaaagaacaaaactcttaa |
44798522 |
T |
|
| Q |
201 |
cacctatg |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
44798521 |
cacctatg |
44798514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University