View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16006_low_103 (Length: 215)
Name: NF16006_low_103
Description: NF16006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16006_low_103 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 16 - 200
Target Start/End: Complemental strand, 38483470 - 38483286
Alignment:
| Q |
16 |
aatatagcaaatacattcaggaataaaacgtaaattcgcagactccccccaaatgagaagataaagagaaacatacagaatctcacgacgatgatcagag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38483470 |
aatatagcaaatacattcaggaataaaacgtaaattcgcagattccccccaaataaggagataaagagaaacatacagaatctcacgacgatgatcagag |
38483371 |
T |
|
| Q |
116 |
ttattatttttaagatcagggagcgagacacttgacttaacatgcaagtaactgcaccagtaagtgtaattacgtagaagattct |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38483370 |
ttattatttttaagatcaggaagcgagacacttgacttaacatgcaagtaactgcaccaggaagtgtaattacgtagaagattct |
38483286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University